View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14981_low_12 (Length: 342)
Name: NF14981_low_12
Description: NF14981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14981_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 14 - 181
Target Start/End: Original strand, 38865741 - 38865904
Alignment:
| Q |
14 |
gataatactaggggtgaaaaacatttcccaagttagttaaattatgcacctagctactatgcccagtacaattaaattcaaaatgaggtgctccaaattc |
113 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38865741 |
gataatactaagggtgaaaaacatttcccaagttagttaaattatgcaccta----ctatgcccagtacaattaaattcaaaatgaggtgctccaaattc |
38865836 |
T |
|
| Q |
114 |
tgatggcaacacaagaatagaactaacattagaaacatagcaaaatggttgaactattattcatcatg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38865837 |
tgatggcaacacaagaatagaactaacattagaaacatagcaaaatggttgaactattattcatcatg |
38865904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 326
Target Start/End: Original strand, 38866018 - 38866049
Alignment:
| Q |
295 |
ctggaaccctaacgactcatctccgtgcaact |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38866018 |
ctggaaccctaacgactcatctccgtgcaact |
38866049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University