View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14981_low_14 (Length: 338)
Name: NF14981_low_14
Description: NF14981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14981_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 4 - 325
Target Start/End: Complemental strand, 26422464 - 26422143
Alignment:
| Q |
4 |
gatggacatcatcaaaattcccgcaaaacctgaagtaaagctcctcactcagaaaaaatttgtgcccatcatcaaaattccagcaactgactcctcccac |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26422464 |
gatggccatcatcaaaattcccgcaaaacctgaagtaaagctcctcactcagaagaaatttgtgcccatcatcaaaattcccgcaactgactcctcccac |
26422365 |
T |
|
| Q |
104 |
ttgacaccactattctcatatcgcccttttcaattttattcctccccaatattcacttttgtactccagattttagttccacttgcagtttcctttgagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26422364 |
ttgacaccactattctcatatcgcccttttcaattttattcctccccaatattcacttttgtactccagattttagttccacttgcagtttcctttgagt |
26422265 |
T |
|
| Q |
204 |
tcttttttatccctaaaatattaatctttccctgaatgtgcatcaccacatgcctgaacttcagctattttctccggctggagtcttaaagtttggaagc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26422264 |
tcttttttatccctaaaatattaatctgtccctgaatgtgcatcaccacatgcctgaacttcagctattttctccggctggagtcttaaagtttggaagc |
26422165 |
T |
|
| Q |
304 |
atcttctcatatagtctcttct |
325 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26422164 |
atcttctcatatagtctcttct |
26422143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University