View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14981_low_30 (Length: 243)
Name: NF14981_low_30
Description: NF14981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14981_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 39915644 - 39915432
Alignment:
| Q |
1 |
taacaatatgaaaagttttttgaatcatgctaatcactaatcagtatccacactggctaaggaatcaataacgaaagttacgtattcagaaatataatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39915644 |
taacaatatgaaaagttttttgaatcatgctaatcactaatcagtatccacactggctaaggaatcaataacgaaagttacgtattcagaaatataatat |
39915545 |
T |
 |
| Q |
101 |
ttaatagtacactaacaactttaacttaaaatatcatatttgaaagaaaaaataaataaaatttgaatccgttgctacttgctagtgtatatctagtttt |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39915544 |
ttaatagt---------actttaacttaaaatatcatatttgaaagaaaaaataaataaaatttgaatccg-------ttgctagtgtatatctagtttt |
39915461 |
T |
 |
| Q |
201 |
tattttgaaaggtatttacatactttttg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39915460 |
tattttgaaaggtatttacatactttttg |
39915432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University