View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14981_low_32 (Length: 240)
Name: NF14981_low_32
Description: NF14981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14981_low_32 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 4591747 - 4591972
Alignment:
| Q |
18 |
atacatgcatccaatcaagccatatcataatgccaattgtttaggttacttccttaaatatctcaaaatataa---acatggggtgatttgataagattc |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4591747 |
atacatgcatccaatcaagccatgtcataatggcaattgtttaggttacttcctcaaatatctcaaaatataataaacatggggtgatctgataagattc |
4591846 |
T |
|
| Q |
115 |
tacgcgtaaaaaagctttacaccgtcagtgctcagcaattaatctctgcaaagtatttctgcctaaaagatttgataggattctacatatgatttttatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4591847 |
aacgcgtaaaaaagctttacaccgtcagttttcagcaattaatctctgcaaagtatttctgcctacaagatttgataggattctacatatgatttttatt |
4591946 |
T |
|
| Q |
215 |
ttgttttgaaaaaatggatcggatcc |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4591947 |
ttgttttgaaaaaatggatcggatcc |
4591972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University