View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14981_low_33 (Length: 238)
Name: NF14981_low_33
Description: NF14981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14981_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 2282630 - 2282835
Alignment:
| Q |
15 |
cataggaacttaaccattttttattatatgaaaattatgaatacaacccctnnnnnnntaatgaataaatgtatgacggtgacgtagatttagtattagt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2282630 |
catatgaacttaaccattttttattatatgaaaattatgaatacaacccctaaaaaaataatgaataaatgtatgacggtgacgtagatttagtattagt |
2282729 |
T |
|
| Q |
115 |
agatatctgaattgcgtactcctcgtagtaattaagactttaattatcgtaccataatgtagggtatttagtgtactctttgccacttcaaaagaaacac |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2282730 |
agatatctgaattgtgtactcctcgtagtaattaagactttaattatcgtaccataatgtagggtatttagtgtactctttgccacttcaaaagaaacac |
2282829 |
T |
|
| Q |
215 |
aagtat |
220 |
Q |
| |
|
|||||| |
|
|
| T |
2282830 |
aagtat |
2282835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University