View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14982_low_6 (Length: 245)
Name: NF14982_low_6
Description: NF14982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14982_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 21902838 - 21902619
Alignment:
| Q |
19 |
tgctattcgttcgacacttttcttgccttgagccaacactagtgtttttcctttgaaagaaatagaacacgataagagggaactcataattgctcatgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21902838 |
tgctattcgttcgacacttttcttgccttgagccaacactggtgtttttcctttgaaagaaatagaacacgataagagcgaactcataattgctcatgaa |
21902739 |
T |
 |
| Q |
119 |
catgcgcnnnnnnngatgaaaagatgcagccaagaatctatgtagtactgacatttagattgaaggcgtgtctagtgttcaacaccgacacatgcagtta |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| | ||| |||||||||| |||||||| |||| |||||| |||||||| ||||| |
|
|
| T |
21902738 |
catgcgcaaaaaaagatgaaaagatgcagccaagaatctacgtagcatcgac--ttagattgaaagcgtgtctggtgtccaacacagacacatgtagtta |
21902641 |
T |
 |
| Q |
219 |
catttaatcatttacattttct |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
21902640 |
catttaatcatttacattttct |
21902619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 41686779 - 41686815
Alignment:
| Q |
176 |
gattgaaggcgtgtctagtgttcaacaccgacacatg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
41686779 |
gattgaaggcgtgtctggtgttcaacaccaacacatg |
41686815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University