View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14982_low_8 (Length: 229)
Name: NF14982_low_8
Description: NF14982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14982_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 15734232 - 15734300
Alignment:
| Q |
1 |
tcatggattgtgctgtctatgctattgtactcatatgcagtctttcgtttgtgcatccataaaacaacg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15734232 |
tcatggattgtgctgtctatgctattgtactcatatgcagtctttcgtttgtgcatccgtaaaacaacg |
15734300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 205
Target Start/End: Original strand, 15734365 - 15734436
Alignment:
| Q |
134 |
tgaattatcgttcagctaggatttttagctattagttcactcatttctttccattatgtgttaatttgattg |
205 |
Q |
| |
|
|||||||||| || ||||||||| ||| ||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
15734365 |
tgaattatcgctctgctaggattgttaactattagttcactgatttctttccatcatgtgttaatttgattg |
15734436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 1581929 - 1581861
Alignment:
| Q |
1 |
tcatggattgtgctgtctatgctattgtactcatatgcagtctttcgtttgtgcatccataaaacaacg |
69 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1581929 |
tcatggattgtgccgtctatgctattgtactcatatgcagtctttcgtttgtgcatccgtaaaacaacg |
1581861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 205
Target Start/End: Complemental strand, 1581796 - 1581725
Alignment:
| Q |
134 |
tgaattatcgttcagctaggatttttagctattagttcactcatttctttccattatgtgttaatttgattg |
205 |
Q |
| |
|
|||||||||| || ||||||||| ||| ||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
1581796 |
tgaattatcgctctgctaggattgttaactattagttcactgatttctttccatcatgtgttaatttgattg |
1581725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University