View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14982_low_9 (Length: 227)
Name: NF14982_low_9
Description: NF14982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14982_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 79 - 227
Target Start/End: Original strand, 36947654 - 36947802
Alignment:
| Q |
79 |
tttctacgcgaaattgggaaattgatttgatacgcaaaaaatttcgcacaagtgttaaagagcttacatcaacaaaactcgaaggatatgttttcccatt |
178 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||| ||||||||| | ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36947654 |
tttctacgcaaaattgggaaattgatttgatgagcaaaaaatttctaacaagtgttgaggagcttacatcaacaaaactccaaggatatgttttcccatt |
36947753 |
T |
 |
| Q |
179 |
actatcagttccacattgctgtaattttctctctatgcatgctgctaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947754 |
actatcagttccacattgctgtaattttctctctatgcatgctgctaaa |
36947802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University