View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14983_high_13 (Length: 239)
Name: NF14983_high_13
Description: NF14983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14983_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 41154459 - 41154681
Alignment:
| Q |
1 |
aaattgtcttgtcctcagggtgagttttttcaacatctaagatgtcacggtacgcggtcatctcttcaataaaaccaacatataaattaatgcaattgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41154459 |
aaattgtcttgtcctcagggtgagttttttcaacatctaagatgtcacggtacgcggtcatctcttcaataaaaccaacatataaattaatgcaattgga |
41154558 |
T |
 |
| Q |
101 |
tcttcaatttaatttgaaaaatgaccacaatcacgttttcgggaagagttatgtgtgannnnnnnnnnngggtagaattatgagcgagtttgaaaccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
41154559 |
tcttcaatttaatttgaaaaatgaccacaaacacgttttcgggaagagttatgtgtga-ctttttttttgggtggaattatgtgcgagtttgaaaccaaa |
41154657 |
T |
 |
| Q |
201 |
ataatcattttataaagttagtga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41154658 |
ataatcattttataaagttagtga |
41154681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University