View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14983_high_15 (Length: 221)

Name: NF14983_high_15
Description: NF14983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14983_high_15
NF14983_high_15
[»] chr2 (5 HSPs)
chr2 (18-204)||(27348501-27348687)
chr2 (26-160)||(28418308-28418442)
chr2 (26-129)||(28406558-28406661)
chr2 (26-156)||(28284811-28284941)
chr2 (26-145)||(28003704-28003823)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 27348501 - 27348687
Alignment:
18 atgaagacgatgctgagaaggagaaacggttcaaaatttttgcggagaaattggaatacatagagaggttcaaccgtgatgggaatgagacttatgagtt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
27348501 atgaagacgatgctgagaaggagaaacggttcaaaatttttgcggagaaattagaatacatagagaggttcaaccgtgatgggaatgagacttatgagtt 27348600  T
118 gggtttgaatcaattttcagatttaactcatgaagagttcgtttctgcatatggttgttcccgtcttgaaaaccatttactagagtc 204  Q
    |||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
27348601 gggtttgaatcaattttcagatttaacatatgaagagtttgtttctgcatatggttgttcccgtcttgaaaaccatttactagagtc 27348687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 26 - 160
Target Start/End: Complemental strand, 28418442 - 28418308
Alignment:
26 gatgctgagaaggagaaacggttcaaaatttttgcggagaaattggaatacatagagaggttcaaccgtgatgggaatgagacttatgagttgggtttga 125  Q
    |||||||||||| | ||||||||||| |||||||| ||||||||||||||||||||||  |||||||||||||| |||| |||||||||||||||| |||    
28418442 gatgctgagaagaataaacggttcaagatttttgcagagaaattggaatacatagagaatttcaaccgtgatggaaatgcgacttatgagttgggtctga 28418343  T
126 atcaattttcagatttaactcatgaagagttcgtt 160  Q
    ||||||  |||||||||||| ||||||||| ||||    
28418342 atcaatactcagatttaactgatgaagagtacgtt 28418308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 26 - 129
Target Start/End: Original strand, 28406558 - 28406661
Alignment:
26 gatgctgagaaggagaaacggttcaaaatttttgcggagaaattggaatacatagagaggttcaaccgtgatgggaatgagacttatgagttgggtttga 125  Q
    ||||||||||||||||||| |||||| |||||||| || |||||||||||  |||||||||||||||||||||| |||||||||||| |||||||| |||    
28406558 gatgctgagaaggagaaacagttcaagatttttgcagaaaaattggaatatgtagagaggttcaaccgtgatggaaatgagacttataagttgggtctga 28406657  T
126 atca 129  Q
    ||||    
28406658 atca 28406661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 26 - 156
Target Start/End: Complemental strand, 28284941 - 28284811
Alignment:
26 gatgctgagaaggagaaacggttcaaaatttttgcggagaaattggaatacatagagaggttcaaccgtgatgggaatgagacttatgagttgggtttga 125  Q
    |||||||||||||||||||| ||||| |||||||| ||||| || |||||||||||||  || ||||||| ||| ||  |||||||| |||||||| |||    
28284941 gatgctgagaaggagaaacgattcaagatttttgcagagaatttagaatacatagagaattttaaccgtgctggaaaacagacttataagttgggtctga 28284842  T
126 atcaattttcagatttaactcatgaagagtt 156  Q
    ||||||| || ||||||||  ||||||||||    
28284841 atcaattctctgatttaacaaatgaagagtt 28284811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 28003704 - 28003823
Alignment:
26 gatgctgagaaggagaaacggttcaaaatttttgcggagaaattggaatacatagagaggttcaaccgtgatgggaatgagacttatgagttgggtttga 125  Q
    |||| |||||||||||||||||| || ||||||||  |||| ||||| ||||| ||||  |||||||||| ||| ||||| ||||||||||||||| |||    
28003704 gatgttgagaaggagaaacggtttaagatttttgcaaagaatttggagtacatcgagaatttcaaccgtgctggaaatgaaacttatgagttgggtctga 28003803  T
126 atcaattttcagatttaact 145  Q
    |||||||||  |||||||||    
28003804 atcaatttttggatttaact 28003823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University