View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14983_low_12 (Length: 263)
Name: NF14983_low_12
Description: NF14983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14983_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 12736902 - 12737147
Alignment:
| Q |
1 |
acattaatcaaagaatttttgtttccatcaaacatcaagtagattgcacagatggcaacaacttgtgggatggtctttttcctataactgaggtttggca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
12736902 |
acattaatcaaagaatttttgtttccatcaaacatcaagtagattgcacagatggcaacaacttgtgggatggtctttttcctaaaacttagatttggca |
12737001 |
T |
 |
| Q |
101 |
atgcatataagggaaattgatgtgtatgtttatggaaacttaatagccaagaccataacttatcataatttgagcacatgaaaaatagttccactttgcc |
200 |
Q |
| |
|
||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12737002 |
atggatataaggaaaattgatgtgtctgtttatggaaacttaatagccaagaccataacttatcataatttgagcacatgaaaaatagttccactttgcc |
12737101 |
T |
 |
| Q |
201 |
cgacaagcccttttcctgtacaaactcccttcagtgggggcattat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12737102 |
cgacaagcccttttcctgtacaaactcccttcagtgggggcattat |
12737147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University