View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14983_low_12 (Length: 263)

Name: NF14983_low_12
Description: NF14983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14983_low_12
NF14983_low_12
[»] chr6 (1 HSPs)
chr6 (1-246)||(12736902-12737147)


Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 12736902 - 12737147
Alignment:
1 acattaatcaaagaatttttgtttccatcaaacatcaagtagattgcacagatggcaacaacttgtgggatggtctttttcctataactgaggtttggca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||    
12736902 acattaatcaaagaatttttgtttccatcaaacatcaagtagattgcacagatggcaacaacttgtgggatggtctttttcctaaaacttagatttggca 12737001  T
101 atgcatataagggaaattgatgtgtatgtttatggaaacttaatagccaagaccataacttatcataatttgagcacatgaaaaatagttccactttgcc 200  Q
    ||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12737002 atggatataaggaaaattgatgtgtctgtttatggaaacttaatagccaagaccataacttatcataatttgagcacatgaaaaatagttccactttgcc 12737101  T
201 cgacaagcccttttcctgtacaaactcccttcagtgggggcattat 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
12737102 cgacaagcccttttcctgtacaaactcccttcagtgggggcattat 12737147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University