View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14983_low_17 (Length: 219)
Name: NF14983_low_17
Description: NF14983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14983_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 69 - 215
Target Start/End: Original strand, 23863092 - 23863238
Alignment:
| Q |
69 |
caaaaacatattttagtcaaatatatatcaccactattcgatcaggttgttaagcaactttgaattacggtaaacgtaaacccttaaggagacagatact |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23863092 |
caaaaacatattttagtcaaatatatatcaccactattcgatcaggttgttaagcaactttgaattacggtaaacgtaaacccttaaggagacagatact |
23863191 |
T |
 |
| Q |
169 |
aatcaagcacgctttacatcttcaaaagataccacttcatctcactc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
23863192 |
aatcaagcacgctttacatcttcaaaagatactacttcttttcactc |
23863238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 23861672 - 23861750
Alignment:
| Q |
1 |
aaaggcaagtaattcatctcactatgcttagaaaaatgtcactaatgtgattttttatcatctcggttcaaaaacatat |
79 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
23861672 |
aaaggcaagtaattcatttcactatgcttagaaaaatgtcactaatgtgattttttatcatctcagttcaaaaatatat |
23861750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University