View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_high_15 (Length: 264)
Name: NF14984_high_15
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 74 - 246
Target Start/End: Original strand, 55477273 - 55477445
Alignment:
| Q |
74 |
catcgcttggatgttgtggtggtagtgatggttaaaccatcggttatggcaggggatgagttgggttcttgaacagggtcgtgtttgttttgggtggaaa |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55477273 |
catcgcttggatgttgtggtggtagtgatggttaaaccatcggttatgggaggggatgagttgggttctggaacagggtcgtgtttgttttgggtggaaa |
55477372 |
T |
 |
| Q |
174 |
ggaggtgaaggggaaggatgacgccgttaaggaagagttgatcggcgggaatgatgttgggttgtgggaaaga |
246 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55477373 |
ggagatgaaggggaaggatgacgccgttaaggaagagttgatcggcgggaatgatgttgggttgtgggaaaga |
55477445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University