View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_high_8 (Length: 381)
Name: NF14984_high_8
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 34 - 368
Target Start/End: Original strand, 19533322 - 19533656
Alignment:
| Q |
34 |
caccccgttttatgcaagagctcttataaaaggtgcaaacaactaaacatctaagaaatggatagataaatattaactaggagcattcaattatnnnnnn |
133 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
19533322 |
caccccgttttatgcaagaactcttataaaaggtgcaaacaactaaacatccaagaaatggatagatgaatattaactaggagcattcaatcataaaaaa |
19533421 |
T |
 |
| Q |
134 |
nttcacttgaaaatgatgaaatgtcattnnnnnnnttgtttaaatcctcgggttacaaatttaaacatggaatacaaagaaatgctgattttagaactca |
233 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19533422 |
attcacttgaaaatgatgaaatgtcattaaaaaaattgtttaaatcctcgggttacaaatttaaacatggaatacaaagaaatgctgattttagaactca |
19533521 |
T |
 |
| Q |
234 |
aggccattttcgcgagctgcatcagcaatagctttaacacggccatggtatgggtaaccacctctgtcaaagactacctttgtgattcctttttccagac |
333 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19533522 |
aggccatgttcgcgagctgcatcagcaatagctttaacacggccatggtatgggtaaccacctctgtcaaagactacctttgtgattcctttttccagac |
19533621 |
T |
 |
| Q |
334 |
aggattttgcaatgatctcacccaccccctttgct |
368 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19533622 |
aggattttgcaatgatctcacccaccctctttgct |
19533656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University