View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_17 (Length: 283)
Name: NF14984_low_17
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 48 - 210
Target Start/End: Original strand, 49712934 - 49713096
Alignment:
| Q |
48 |
ccaaactgatgtgagactgttcttcggatgcgactcaacaaagctacccagagaactgcaaaggaacacaattggttgctctgcagaaaatgaaacgagt |
147 |
Q |
| |
|
||||| ||| |||| | |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
49712934 |
ccaaagtgaagtgaaattgttcttcggatgcgattcaacaaagctacccagagagctgcaaaggaacacaattggttgctctgaagaaaacaaaacgagt |
49713033 |
T |
 |
| Q |
148 |
tcggttgtggcattgtatgcagatgataaaaatgcaagcttggtgtcaaagaattgcagggat |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49713034 |
tcggttgtggcattgtatggcgatgataaaaatgcaagcttggtgtcaaagaattgcagggat |
49713096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 48 - 210
Target Start/End: Original strand, 49655412 - 49655574
Alignment:
| Q |
48 |
ccaaactgatgtgagactgttcttcggatgcgactcaacaaagctacccagagaactgcaaaggaacacaattggttgctctgcagaaaatgaaacgagt |
147 |
Q |
| |
|
||||| ||| |||| | |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
49655412 |
ccaaagtgaagtgaaattgttcttcggatgcgattcaacaaagctacccagagagctgcaaaggaacacaattggttgctctgaagaaaacaaaacgagt |
49655511 |
T |
 |
| Q |
148 |
tcggttgtggcattgtatgcagatgataaaaatgcaagcttggtgtcaaagaattgcagggat |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49655512 |
tcggttgtggcattgtatgatgatgataaaaatgcaagcctggtgtcaaagaattgcagggat |
49655574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 207 - 266
Target Start/End: Original strand, 49655654 - 49655713
Alignment:
| Q |
207 |
ggattgctagtgattgcaatgcgtgtaacagcaccggaggaaggtgtggctttgataaag |
266 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49655654 |
ggatagctagtgattgcaatgagtgtaacagcactggaggaaggtgtggctttgataaag |
49655713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 207 - 266
Target Start/End: Original strand, 49713176 - 49713235
Alignment:
| Q |
207 |
ggattgctagtgattgcaatgcgtgtaacagcaccggaggaaggtgtggctttgataaag |
266 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49713176 |
ggatagctagtgattgcaatgagtgtaacagcactggaggaaggtgtggctttgataaag |
49713235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 49655142 - 49655183
Alignment:
| Q |
1 |
caaccaaagtataagctaccctttctatatcaaaggattaca |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
49655142 |
caaccaaagtataagctaccctttctatataataggattaca |
49655183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 49712664 - 49712705
Alignment:
| Q |
1 |
caaccaaagtataagctaccctttctatatcaaaggattaca |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
49712664 |
caaccaaagtataagctaccctttctatataataggattaca |
49712705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 73 - 127
Target Start/End: Original strand, 28448730 - 28448784
Alignment:
| Q |
73 |
ggatgcgactcaacaaagctacccagagaactgcaaaggaacacaattggttgct |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
28448730 |
ggatgcgactcaacaaagctactcagagtgctgcaaaggaacacaatcggttgct |
28448784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University