View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_19 (Length: 263)
Name: NF14984_low_19
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 35157237 - 35157001
Alignment:
| Q |
11 |
taatactgaactgtctcatatcctaaatcaaatattagtccttattttacgtccatacaattctctctcttctttcaataatataaaaaatgttgcttag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35157237 |
taattctgaactgtctcatatcctaaatcaaatattagtccttattttacgttcatacaattctctctcttctttcaataatataaaaaatgttgcttag |
35157138 |
T |
 |
| Q |
111 |
gcttaggataatatgattattagtttcatcaaacgaactgatta-nnnnnnncaaaggaatcaaaccaacttattagaatctcccacaaccgccatagtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35157137 |
gcttaggataatatgattattagtttcatcaaaccaactgattattttttttcaaaggaatcaaaccaacttattagaatctcccacaaccgccatagtg |
35157038 |
T |
 |
| Q |
210 |
atttgtcggtttgtgtcagctataatacttctcaagt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35157037 |
atttgtcggtttgtgtcagctataatacttctcaagt |
35157001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University