View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_20 (Length: 259)
Name: NF14984_low_20
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 44845945 - 44846193
Alignment:
| Q |
11 |
ttatactacatagtttaggaaatattgaattttgacttgggttaaaatacctcatccaatctttactttttgtatggtcagtataaatattttacagtaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44845945 |
ttatactacatagtttaggaaatattgaattttgacttgggttaaaatacctcatccaatctttactttttgtatggtcagtataaatattttactgtaa |
44846044 |
T |
|
| Q |
111 |
cctaatcataagttgagtatctctctctggtcactgatgtatctcccaaatgtttcctcctctcctaggtggaaacacttcaacttgcatcagtataagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44846045 |
cctaatcataagttgagtatctctctctggtcactgatgtatctcccaaatgtttcctcctctcctaggtggaaacacttcaacttgcatcagtataagt |
44846144 |
T |
|
| Q |
211 |
tgtagaacagttaaaggaatgtagcaacataggtgcccattttttgtgt |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
44846145 |
tgtagaacagttaaaagaatgtagcaacataggtgcccatttttcgtgt |
44846193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University