View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_23 (Length: 243)
Name: NF14984_low_23
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 43951351 - 43951580
Alignment:
| Q |
1 |
aaagtggtggtggtggatgtgcatgctgatatggaagtactaaataattgcaggcactcccttcaatgctgt--ttcaaattcttcaaattctttttggt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43951351 |
aaagtggtggtggtggatgtgcatgctgatatggaagtactaaataattgcaggcactcccttcaatgctgtgtttcaaattcttcaaattctttttggt |
43951450 |
T |
 |
| Q |
99 |
catatagtgtactacactgtatgccatgattgtgtgggtaaattgtgtacctcgatgttccctttttgatagtactattgttttgggaaggatgagcttg |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43951451 |
catatagtgtactacgctgtatgccatgattgtgtgggtaaattgtgtacctcgatgttccctttttgatagtactattgttttgggaaggatgagcttg |
43951550 |
T |
 |
| Q |
199 |
agaatgttgcacacttggggaaaacatatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43951551 |
agaatgttgcacacttggggaaaacatatt |
43951580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University