View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_25 (Length: 242)
Name: NF14984_low_25
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_25 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 242
Target Start/End: Complemental strand, 1052716 - 1052491
Alignment:
| Q |
15 |
atcatcaacacacaatcaggccctgggaggattttgtaaaaataaaacagaaggtcctataatcctaggaatcaaacacaagtaattgtaatttcataaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1052716 |
atcatcaacacacaatcaggccctgggaggattttgtaaaaataaaacagaaggtccta--atcctaggaatcaaacgcaagtaattgtaatttcataaa |
1052619 |
T |
|
| Q |
115 |
gagctcatcccaccaaccaaattagtacgataacaaattttatatgcatacatactttcaatattaaatcaataatttgaaagaacactaacatcacact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1052618 |
gagctcatcccaccaaccaaattagtacgataacaaattttatatgcatatatacttccaatattaaatcaataatttgaaagaacactaacatcacact |
1052519 |
T |
|
| Q |
215 |
cttgaacgcatgactcacattccaacac |
242 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
1052518 |
cttgaacgcatgactcacattctaacac |
1052491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University