View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_27 (Length: 238)
Name: NF14984_low_27
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 4051948 - 4051862
Alignment:
| Q |
1 |
tttttggctattttgttacagtttgtgtgtttcttcatcatgatgcactatacaaggttgttgcattactctaaattgttgtgcttc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051948 |
tttttggctattttgttacagtttgtgtgtttcttcatcatgatgcactatacaaggttgttgcattactctaaattgttgtgcttc |
4051862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 4051799 - 4051747
Alignment:
| Q |
149 |
agctatgagtgtatgtttagttttatggtgagtttgaccaaattacgatatat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051799 |
agctatgagtgtatgtttagttttatggtgagtttgaccaaattacgatatat |
4051747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 231
Target Start/End: Complemental strand, 4051734 - 4051704
Alignment:
| Q |
201 |
ttgataaaattagactctcaagcttcacctt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4051734 |
ttgataaaattagactctcaagcttcacctt |
4051704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University