View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_28 (Length: 237)
Name: NF14984_low_28
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 24400195 - 24400421
Alignment:
| Q |
1 |
ttatccagttccctaagatatgtgtgtgttgcgtattaacttcaatttaatgaaatatggcctagtttgcatttattattgttaactcgggattttcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24400195 |
ttatccagttccctaagatatgtgtgtgttgagtattaacttcaatttcatgaaatgcggcctagtttgtatttattattgttaactcgggattttcaat |
24400294 |
T |
|
| Q |
101 |
cgtatgcagcaaacctcagcttccattgagttataggctttgatttcaagatgaatggaagaaactctcaccaagtatcagacagtgcttctggtactta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24400295 |
cgtatgcagcaaacctcagcttccattgagctataggctttgatttcaagatgaatggaagaaactctcaccaagtatcagacagtgcttctggtactta |
24400394 |
T |
|
| Q |
201 |
tgatgattctgatatttatgatgatga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24400395 |
tgatgattctgatatttatgatgatga |
24400421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University