View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_32 (Length: 223)
Name: NF14984_low_32
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 38589324 - 38589136
Alignment:
| Q |
18 |
gtattgtaccatgccacctgccacctaaattattttcgtccttcaaatttaaaatttcaaatcctttgaaatttgtatgtgcatgtaggtacatatttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38589324 |
gtattgtaccatgccacctgccacctaaattattttcgtccttcaaatttaaaatttc-----ctttgaaatttgtatgtgcatgtaggtacatatttgg |
38589230 |
T |
 |
| Q |
118 |
cttaattattcttttgatctcttgtcagattcaagttgctttcgtaacttttaaaaagtgtcactttggttttttaattcaacatttcatctca |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38589229 |
cttaattattcttttggtctcttgtcagatttaaattgctctcataacttttaaaaagtgtcactttggttttttaattcaacatttcatctca |
38589136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University