View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_33 (Length: 215)
Name: NF14984_low_33
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 2530452 - 2530631
Alignment:
| Q |
1 |
caatccgtacatgcagatggtgtatgcatgtgagttattttttcccttgtgtttttaattctatccttttagatacttatgaatttacaaaccataatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2530452 |
caatccgtacatgcagatggtgtatgcatgtgagttattttttcccttgtgtttttaattctatccttttagatacttatgaatttacaaaccataatgg |
2530551 |
T |
 |
| Q |
101 |
aatatcattacttccaaaatatgtatcttttttgtttattattcttgtaggtactagttgatgccaaatgttatctctct |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2530552 |
aatatcattacttccaaaatatgtatcttttttgtttattattcttgtaggtactagttgatgccaaatgttatctctct |
2530631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 50
Target Start/End: Original strand, 23896741 - 23896789
Alignment:
| Q |
3 |
atccgtacatgcagatggtgtatgcatgtgagttattttt-tcccttgt |
50 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
23896741 |
atccatacatgcagttggtttatgcatgtgagttatttttctcccttgt |
23896789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University