View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14984_low_8 (Length: 402)
Name: NF14984_low_8
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14984_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 6e-87; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 14542676 - 14542485
Alignment:
| Q |
19 |
ggatgagtgtgtggttttatagtgcacaaagacaatttaaaatctactannnnnnnggactcaatttctgaaatctattagtaaaaatgtttatggtgtt |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14542676 |
ggatgagtgtgtggctttatagtgcacaaagacaatttaaaatctactatttttttggactcaatttctgaaatctattagtaaaaatgtttatggtgtt |
14542577 |
T |
|
| Q |
119 |
attttggtggctataagatatttgtccatttgcaagtggctggttacgtaccaccattgtggaccaggaatattatatgaacatgcactgag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14542576 |
attttggtggctataagatatttgtccatttgcaagtggctggttacgtaccaccattgtggaccagaaatattatatgaacatgcactgag |
14542485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 302 - 378
Target Start/End: Complemental strand, 14542393 - 14542317
Alignment:
| Q |
302 |
attattatcagttctatgtttcctttctctctttcctgaaaaataaaatgttttctttcacttttctatgcatcaca |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14542393 |
attattatcagttctatgtttcctttctctctttcctgaaaaataaaatgtttcctttcacttttctatgcatcaca |
14542317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 14580915 - 14580952
Alignment:
| Q |
19 |
ggatgagtgtgtggttttatagtgcacaaagacaattt |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14580915 |
ggatgagtgtgtggttttatagtgcacaaggacaattt |
14580952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University