View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14985_low_2 (Length: 374)
Name: NF14985_low_2
Description: NF14985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14985_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 142 - 333
Target Start/End: Complemental strand, 50453607 - 50453409
Alignment:
| Q |
142 |
ttaacaagcctgtttcttcagtccaagttggtaagaatattaatgaacataactggtctagatcaaggatatat-------atagatcgaccattaatta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50453607 |
ttaacaagcctgtttcttcagtccaagttggtaagaatattaatgaacataactggtctagatcaaggatatatcatatatatagatcgaccattaatta |
50453508 |
T |
 |
| Q |
235 |
attccnnnnnnnnatgtatcaccaaaaaaggttaacttctttttatttagagtttatataagtaaaaactgtacctagcattaaaaattatgagtgaga |
333 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453507 |
atttcttttttttatgtatcaccaaaaaaggttaacttctttttatttagagtttatataagtaaaaactgtacctagcattaaaaattatgagtgaga |
50453409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University