View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14986_low_24 (Length: 293)
Name: NF14986_low_24
Description: NF14986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14986_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 28143991 - 28144267
Alignment:
| Q |
1 |
tttatgactagaagtgaattgtgaagttatatgatgtttttgttgcagatatgtttctattcggacgttggagagtgattgtcgttccagtaatcaacgt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143991 |
tttatgactagaagagaattgtgaagttatatgatgtttt-gttgcagatatgtttctattcggacgttggagagtgattgtcgttccagtaatcaacgt |
28144089 |
T |
|
| Q |
101 |
tgtcttgttttttgggttctctttgctttctctatgatcattgaacgtgaatttgcagtgttatttagttggtaatttcac----nnnnnnnnnnnnnna |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28144090 |
tgtcttgttttttgggttctctttgctttctctatgatcattgaacgtgaatttgcagtgttatttagttggtaatttcacttttttattttatttttta |
28144189 |
T |
|
| Q |
197 |
tatagtaagtctcattactttgcttttattattttccgatcataagtagggcaaacaaccattttggtcggcgctgtc |
274 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28144190 |
tatactaagtctcattactttgcttttattattttccgattataagtagggcaaacaaccattttggtcggcgctgtc |
28144267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University