View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14986_low_26 (Length: 270)
Name: NF14986_low_26
Description: NF14986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14986_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 98 - 254
Target Start/End: Complemental strand, 46169553 - 46169397
Alignment:
| Q |
98 |
gtgataagaatacaagaagcaattggacttggtcaaagaatcgaacggtatgaaatttatgtggatggtaaatcaataatccaagggacaacaattggtt |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46169553 |
gtgattagaatacaagaagcaattggacttggtcaaaggatcgaacggtatgaaatttatgtggatggtaaatcaataatccaagggacaacaattggtt |
46169454 |
T |
|
| Q |
198 |
acaagaggcttcataggcttgatggagatgttgtgcatgctcgtgttgtgagaatta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46169453 |
acaagaggcttcataggcttgatggagatgttgtgcatgctcgtgttgtgagaatta |
46169397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University