View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14986_low_29 (Length: 250)
Name: NF14986_low_29
Description: NF14986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14986_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 53 - 240
Target Start/End: Original strand, 45406447 - 45406633
Alignment:
| Q |
53 |
attccttcttgtttgaattacacgcagacatgatgtcattctacattatcttttatcttatatatatgataaatgaattgttccatgtatttggatctat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45406447 |
attccttcttgtttgaattacacgcagacatgatgtcattctacattatcttt-atcttatatatatgataaatgaattgttccatgtatttggatctat |
45406545 |
T |
|
| Q |
153 |
cttgatgtttttagtggttggacactagagaaatcacaatttaaagtatgggaatatatatgtttttgatattttaacactccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45406546 |
cttgatgtttttagtggttggacactagagaaatcacaatttaaagtatgggaatatatatgtttttgatattttaacactccctttg |
45406633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 45406399 - 45406434
Alignment:
| Q |
1 |
ctgcaatttataattagaaaattaatgaataaaaag |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45406399 |
ctgcaatttataattagaaaattaatgaataaaaag |
45406434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 77 - 197
Target Start/End: Original strand, 23051160 - 23051272
Alignment:
| Q |
77 |
cagacatgatgtcattctacattatcttttatcttatatatatgataaatgaattgttccatgtatttggatctatcttgatgtttttagtggttggaca |
176 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| | || |||||||||| |
|
|
| T |
23051160 |
cagagatgatgtcattctacattatct--------atatatatgataaatgaattgtcccatgtatttggatctatcctgatatcattcttggttggaca |
23051251 |
T |
|
| Q |
177 |
ctagagaaatcacaatttaaa |
197 |
Q |
| |
|
| | ||| ||||||||||||| |
|
|
| T |
23051252 |
ccacagagatcacaatttaaa |
23051272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University