View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14986_low_30 (Length: 238)
Name: NF14986_low_30
Description: NF14986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14986_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 39089221 - 39089011
Alignment:
| Q |
17 |
cagtagactatctcttaatttatgtgttatttcctaatttgtaaaagaacccattctctgtcctgcgatgacagtgaagtgattgttattaatagatcgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39089221 |
cagtagactatctcttaatttatgtgttatttcctaatttgtaaaagaacccattctccgtcctgcgataacagtgaagtgattgttattaatagatcgt |
39089122 |
T |
|
| Q |
117 |
tgtttctactaattttatcactatagatgtaagtttctatcatattatgaataaaaaagtgctagtaaacactcactctggcactctttgctacaatatc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39089121 |
tgtttctactaattttatcactatagatgtaagtttctatcatattatgaataaaaaagtgctagcaaacactcactctggcactctttgctacaatatc |
39089022 |
T |
|
| Q |
217 |
aatattcttgg |
227 |
Q |
| |
|
|||||| |||| |
|
|
| T |
39089021 |
aatattattgg |
39089011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University