View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14986_low_33 (Length: 220)

Name: NF14986_low_33
Description: NF14986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14986_low_33
NF14986_low_33
[»] chr6 (2 HSPs)
chr6 (40-204)||(1512780-1512933)
chr6 (1-41)||(1512720-1512760)


Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 40 - 204
Target Start/End: Original strand, 1512780 - 1512933
Alignment:
40 ggatagattacttggttcatcgaaaactccacattccaagcttttcgcgttacaagatcagtcgcatagtaataagaagatgtagaaaaaagcggaaggt 139  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||           ||    
1512780 ggatagattacttcgttcatcgaaaactccacattccaagcttttcgcgttacaagatcagtcgcatagtaagaagaagatgtagaa-----------gt 1512868  T
140 tatgtggttgaagctgaattctctaagaaggttgcagaatcttctacttaccaaagatatgaaac 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1512869 tatgtggttgaagctgaattctctaagaaggttgcagaatcttctacttaccaaagatatgaaac 1512933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 1512720 - 1512760
Alignment:
1 aaaacgtaaagatgaagaaatgacaacatcagtcatgctgg 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
1512720 aaaacgtaaagatgaagaaatgacaacatcagtcatgctgg 1512760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University