View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14986_low_35 (Length: 205)
Name: NF14986_low_35
Description: NF14986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14986_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 19 - 179
Target Start/End: Original strand, 21942008 - 21942168
Alignment:
| Q |
19 |
agtattttgttcccattcttaactatatgaaaatgactaagattatgaagtgcataaaaggtacacggctttatgcaaaccactaataaatcctagaagt |
118 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21942008 |
agtattttgttcacatttttaactatatgaaaataagtaagattatgaagtgcataaaaggtacatggctttatgcaaaccactaataaatcctagaagt |
21942107 |
T |
 |
| Q |
119 |
gcatattctcatgccttagggtactctgaaaaacagtttattttatatgtttattaaataa |
179 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21942108 |
ccatattctcataccttagggtgctctgaaaaacagtttattttatgtgtttattaaataa |
21942168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 10 - 106
Target Start/End: Complemental strand, 10800178 - 10800083
Alignment:
| Q |
10 |
atttcatcaagtattttgttcccattcttaactatatgaaaatgactaagattatgaagtgcataaaaggtacacggctttatgcaaaccactaata |
106 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| ||| ||||| |||||||||| ||||||||||| |
|
|
| T |
10800178 |
atttcatcaagtattttgtttccattcttaactatatgaaaatgagtaagactatgaagtgcatgaaaagtacatggctttatgc-aaccactaata |
10800083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University