View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14988_high_3 (Length: 304)
Name: NF14988_high_3
Description: NF14988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14988_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 32906591 - 32906827
Alignment:
| Q |
17 |
atcacttttgttggcgagtttagaaatagattgggaaatttactacggttgattgtatgttaaatttggattactttggatttggaacattagatttgga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32906591 |
atcacttttgttggcgagtttagaaatagattgggaaatttactaaggttgattgtatgttaaatttggattactttggatttggaacattagatttggt |
32906690 |
T |
 |
| Q |
117 |
tttacgctgttttcccctcgacaataactttacttgcaacgctgcatcataattagtgaaaaatacccaaattcactttcttgcttgagttttaatcaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32906691 |
tttacgctgttttcccctcgacaataactttacttgcaacgctgcatcataattagtgaaaaatacccaaattcactttcttgcttgagttttaatcaat |
32906790 |
T |
 |
| Q |
217 |
gcaatgtttctcaatctttttcgaaatattgcttata |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32906791 |
gcaatgtttctcaatctttttcgaaatattgcttata |
32906827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University