View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_101 (Length: 373)
Name: NF1498_high_101
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 137 - 355
Target Start/End: Complemental strand, 45175809 - 45175591
Alignment:
| Q |
137 |
ttcgggacatacactgaagatgaggatgctatagatgaggacgaagatgaagaggttgataagttttccttctgatgtgattttatgaacgtttggattg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175809 |
ttcgggacatacactgaagatgaggatgctatagatgaggacgaagatgaagaggttgataagttttccttctgatgtgattttatgaacgtttggattg |
45175710 |
T |
|
| Q |
237 |
catcggaactagcgcttgtataggaccttgacttcatttggtacatgcatactaccttcgtagtatgactgactgccgatttattgccctgttatttcat |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45175709 |
catcggaactagcgcttgtataggaccttgacttcatttggtacatgcatactaccttcgtagtacgactgactgccgatttattgccctgttatttcat |
45175610 |
T |
|
| Q |
337 |
acattctatcagcattatt |
355 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45175609 |
acattctatcagcattatt |
45175591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 45175927 - 45175864
Alignment:
| Q |
19 |
taggagggagatggagaaatctggaggggaaactgtagtgttgagcactggtttgaaaaacaaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175927 |
taggagggagatggagaaatctggaggagaaactgtagtgttgagcactggtttgaaaaacaaa |
45175864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University