View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_106 (Length: 365)
Name: NF1498_high_106
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 52503732 - 52504068
Alignment:
| Q |
1 |
aaatcaaatacccattacacagtagttcgtgtgacgagggactaattcggggacagtcgaaggtatcaaaatctgttatggctccgagaatcctactctg |
100 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52503732 |
aaatcaaatacccatcacacactagttcgtgtgacgagggactaattcggggacagtcaaaggtatcaaaatctgttatggctccgagaatcctactctg |
52503831 |
T |
 |
| Q |
101 |
cggcgacgttaacggccgtcttaaccagctcttcaagcgcgtctcatcggtaacactatatannnnnnnnnnnnnnnnnnnagggttttgtttttgttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
52503832 |
cggcgacgttaacggccgtcttaaccagctcttcaagcgcgtctcatcggtaacactatct------------ctctctctagggttttgtttttgttca |
52503919 |
T |
 |
| Q |
201 |
tcagttaaatgctctgcaccactgaatcctttcaatataggtgaacaaatccgcgggcccattcgacgcactcttatgcgttggccagttcttccctgac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52503920 |
tcagttaaatgctctgcaccactgaatcctttcaatataggtgaacaaatccgcgggcccattcgacgcactcttatgcgttggccagttcttccctgac |
52504019 |
T |
 |
| Q |
301 |
tcaccggacctgcttgatgacttcacggcatacattgaaggtggtggat |
349 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52504020 |
tctccggacctgcttgatgacttcacggcatacattgaaggtggtggat |
52504068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University