View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_high_150 (Length: 312)

Name: NF1498_high_150
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_high_150
NF1498_high_150
[»] chr5 (2 HSPs)
chr5 (1-177)||(7646166-7646344)
chr5 (265-308)||(7646038-7646081)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 7646344 - 7646166
Alignment:
1 gctatcatgatttacaacatgcactaactatttgtgctaggcatcaacgataaataaattaattgatgtgttatttttaatccaaggagccaatttagat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
7646344 gctatcatgatttacaacatgcactaactatttgtgctaggcatcaacgataaataaattaattgatgtgttatttttaatcgaaggagccaatttagat 7646245  T
101 tcatatgatca-nnnnnnnncattactaagacaaataaattaacaatgaaaacttagaggac-aaacaaaattaaatat 177  Q
    ||||||| |||         |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||    
7646244 tcatatgttcatttttttttcattactaagacaaataaattaacaatgaaaacttagaggacaaaaaaaaattaaatat 7646166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 308
Target Start/End: Complemental strand, 7646081 - 7646038
Alignment:
265 tatgtgttctgagatggattaatattgtgaagggagatgatgtc 308  Q
    |||||||||||||||||||||||||||||||||||  |||||||    
7646081 tatgtgttctgagatggattaatattgtgaagggatgtgatgtc 7646038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University