View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_155 (Length: 309)
Name: NF1498_high_155
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_155 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 301
Target Start/End: Complemental strand, 28675636 - 28675341
Alignment:
| Q |
18 |
tttggtgggtcccacatactctcttttgttgccattttgttaggaaggattcagtttgctgctttggatttcgaagaaaaggtaaagcttcaaaagtttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28675636 |
tttggtgggtcccacatactctcttttgttgccattttgttaggaaggattcagtttgctgctttggatttcgaagaaaaagtaaagcttcaaaagtttc |
28675537 |
T |
 |
| Q |
118 |
agaagcttcaatgaaaaatggttcaaaagaatcacatatagaagaagaag------------aagaggaaaataacagagtatttaaagctaaagtttta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28675536 |
agaagcttcaatgaaaaatggttcaaaagaatcatatatagaagaagaagaagaagaagaagaagaagaaaataacagagtatttaaagctaaagtttta |
28675437 |
T |
 |
| Q |
206 |
gtttctgattctaatgattcttccactttttgttctactccaccaaaaaatgctttgttactaactagatgcaaatcagcaccatatagttcatct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675436 |
gtttctgattctaatgattcttccactttttgttctactccaccaaaaaatgctttgttactaactagatgcaaatcagcaccatatagttcatct |
28675341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University