View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_161 (Length: 301)
Name: NF1498_high_161
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_161 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 9 - 284
Target Start/End: Original strand, 45164308 - 45164583
Alignment:
| Q |
9 |
atcacttatcagggtgtagtcaatttagtccctaaaaattaacgaaattttaaaatgattcctgaaataaaaaatcgttgattacattggtctttttctg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45164308 |
atcacttatcagggtgtagtcaatttagtccctaaaaattaacgaaattttaaaatgattcctgaaataaaaaatcgttgattacattggtctttttctg |
45164407 |
T |
 |
| Q |
109 |
tcggccaatttagtccgtaaaagtttattgtaatagaagaatttgaatttctgcgattattttgaattttagttgagtgccttacacctataatttaaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45164408 |
tcggccaatttagtccgtaaaagtttattgtaatagaagaatttgaatttctgcgattattttgaattttagttgagtgccttacacctataatttaaag |
45164507 |
T |
 |
| Q |
209 |
actaaatgtatgattcactttgnnnnnnncaccgagctgaggtgatgcaggcacagaaaattcctgttatgtcatt |
284 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45164508 |
actaaatgtatgattcactttgtttttttcaccgagctgaggtgatgcaggcacagaaaattcctgttatgtcatt |
45164583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University