View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_169 (Length: 292)
Name: NF1498_high_169
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_169 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 292
Target Start/End: Complemental strand, 3123618 - 3123339
Alignment:
| Q |
18 |
aacagattctacaaacgttggtggcttgctgcattgttcgccatcacacaaagattaaaagacttgctgctgctcgtcgccactatttgtcatttgggtt |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3123618 |
aacagattctagaaacgttggtggcttgctgcgttgttcgccatcacacaaagattaaaagacttgctgctgctcgtcgccactatttgtcatttgggtt |
3123519 |
T |
 |
| Q |
118 |
tcatca-taaaaaatgttatgtatagtagtgcggtaaaacaataaaataaaatggtttaacttcttatattgcaacataaatggaagaacatacgaattt |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3123518 |
tcatcactaaaaaatgttatgtatagtagtgcggtaaaacaataaaacaaaatggtttaacttcttatattgcaacataaatggaagaacatacgaattt |
3123419 |
T |
 |
| Q |
217 |
tacatcattggaagcaac--------caaaaattaacaaaatatggtaaatataattgtctcgagtttagatatacaagtttgc |
292 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
3123418 |
tacatcattgtaagcaactacaattgcaaaaattaacaaaatattg----tataattgtctcgagtttagatatacaagtttgc |
3123339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University