View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_180 (Length: 286)
Name: NF1498_high_180
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_180 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 266
Target Start/End: Original strand, 5168012 - 5168267
Alignment:
| Q |
11 |
aaatctgcacgtttggttcaaacttaaattggaaatatactcatttatttgtggctgcttgttgagaaaatgtttggagaaaatgcgattatttcttaat |
110 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||| || |||||| | ||||||||||||| | |||||||||||| |
|
|
| T |
5168012 |
aaatctgcatgttctgttcaaacttaaattggaaatatactcatttatatgtggctgtttcttgagattttttttggagaaaatgtgcttatttcttaat |
5168111 |
T |
|
| Q |
111 |
atattaacattttgagtgtgttagatcatagtttgaatgttttatgtatatggtttcaggttgaacagcctttatgccttgactgcatgcgagttttgtc |
210 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5168112 |
atattaacattttaagtgtgttaggtcatagttttaatgttttatgtatatggtttcaggttgaacagcctttatgccttgattgcatgcgagttttgtc |
5168211 |
T |
|
| Q |
211 |
tgataagcttgataaagaggtcgaagatgtaaatagggacattgaagcatatgaag |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5168212 |
tgataagcttgataaagaggtcgaagatgtaaatagggacattgaagcatatgaag |
5168267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University