View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_184 (Length: 282)
Name: NF1498_high_184
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_184 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 9426497 - 9426280
Alignment:
| Q |
12 |
aatacttatggaaattggaacaaaagtgtgaacacgataacattgaatttcaaaaatgatggataagataaatgagccacttagcttggaatggaaaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9426497 |
aatacttatggaaattggaacaaaagtgtgaacacgataacattgaatttcaaaaatgatggataagataaatgagccactt-----ggaatggaaaatg |
9426403 |
T |
|
| Q |
112 |
aagcgaagttgaccaaacattatta---catgtttatcacatcacatttaataactaatgaccctacattgttatttgaaacctcttgttaacaatccac |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9426402 |
aagcgaagttgaccaaacattattattacatgtttatcacatcacatttaataactaatgaccctacattgttatttgaaacctcttgttaacaatccac |
9426303 |
T |
|
| Q |
209 |
gtgggagtagcatatccataaca |
231 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9426302 |
gtgggagtagcatatccataaca |
9426280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University