View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_193 (Length: 274)
Name: NF1498_high_193
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_193 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 17783054 - 17782937
Alignment:
| Q |
1 |
tcgtaggtgcaagaagtcgcagctaccacaatgtcgaggagtcctagtgtttcgccattgaagaagtggaattgctcattaaaaccttccttgacccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17783054 |
tcgtaggtgcaagaagtcgcagctaccacaatgtcgaggagtcctagtgtttcgccgttgaagaagtggaatttctcattaaaaccttccttgacccctt |
17782955 |
T |
 |
| Q |
101 |
cttcaaacaccacaagta |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17782954 |
cttcaaacaccacaagta |
17782937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 158 - 256
Target Start/End: Complemental strand, 17782897 - 17782799
Alignment:
| Q |
158 |
cccgtgattggaatatgcggtagctactaggaatgatctaaacattgtcaaaataaacgtacgttatatatcaaacaagccgacagtttgagtggttaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17782897 |
cccgtgattggaatatgcggtagctactaggaatgatctaaacattttcaaaataaacgtacgttatgtatcaaacaagccgacagtttgagtggttaa |
17782799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University