View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_216 (Length: 253)
Name: NF1498_high_216
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_216 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 5 - 171
Target Start/End: Original strand, 14368059 - 14368225
Alignment:
| Q |
5 |
ctctataaaaaataactaatctcgtcccattttgttaattaaaatgctagcaacacatttaacaaacaatatcttttattaattaaaatgaatacggctc |
104 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
14368059 |
ctctataaaaaataactaatctcgtctcattttgttaattaaaatgctagcaacacatttaacacacaatatcttttattaattaaaatgcatacgactc |
14368158 |
T |
|
| Q |
105 |
tctcatacgagactcacatgattcgatggaatctatgaaaatcttgaccaatcaaaatgtgtgtctg |
171 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14368159 |
tctcatacgagactcacatgatttgatggaatctatgaaaatcttgaccaatcaaaatgtgtgtctg |
14368225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University