View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_224 (Length: 250)
Name: NF1498_high_224
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_224 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 33 - 234
Target Start/End: Complemental strand, 48925678 - 48925477
Alignment:
| Q |
33 |
ggtgacgtttgtgtgtgtgtaaaaaagtttgagcgttgtagacattgcaagaagagaatggtcaaaggtaaatagagttgtattgactttggactatgaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48925678 |
ggtgacgtttgtgtgtgtgtaaaaaagtttgagcgtcgtagacattgcaagaagagaatggtcaaaggtaaaaagagttgtattgactttggactatgaa |
48925579 |
T |
 |
| Q |
133 |
ggagtcttcccggaaatattgtatagagactttcatgtttcattcatacagttgtaacataaatttatatctccgtgttcttctctttttctctcccact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48925578 |
ggagtcttcccggaaatattgtatagagactttcatgtttcattcatacagttgtaacataaatttatatctccgtgttcttctctttttctctcccact |
48925479 |
T |
 |
| Q |
233 |
tt |
234 |
Q |
| |
|
|| |
|
|
| T |
48925478 |
tt |
48925477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University