View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_226 (Length: 249)
Name: NF1498_high_226
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_226 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 17 - 165
Target Start/End: Original strand, 32899814 - 32899962
Alignment:
| Q |
17 |
acactctaattgcaccctgccaagtgaatgtggcaaatcttttatcctatttatttcctttcttttctatagctagttaaattaataatcttcgtattcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32899814 |
acactctaattgcaccctgccaagtgaatgtggcaaatcttttatcctatttatttcctttcttttctatagctagttaaattaataatcttcgtattcg |
32899913 |
T |
 |
| Q |
117 |
ttgctttaccttccttaaatttgtaccaaaaataagatattgtatttag |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32899914 |
ttgctttaccttccttaaatttgtaccaaaaataagatattgtatttag |
32899962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 32881859 - 32881894
Alignment:
| Q |
17 |
acactctaattgcaccctgccaagtgaatgtggcaa |
52 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32881859 |
acacactaattgcaccctgccaagtgaatgtggcaa |
32881894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University