View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_229 (Length: 248)
Name: NF1498_high_229
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_229 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 37358973 - 37358744
Alignment:
| Q |
1 |
ttgggtgcaatgaagaaataaccaaaagagaatgtggtccaaatcccaagcttcgccgtccagaaagatacgttattcgttacattggattttgttctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37358973 |
ttgggtgcaatgaagaaataaccaaaagagaatgtggtccaaatcccaagcttcgccgtccagaaagatacgttattcgttacattggattttgttctct |
37358874 |
T |
|
| Q |
101 |
cattatttgcactgtcagttcttggttgccagccattttcataaacaatgtcagagaatgtccacaacaaaacaaaaataaaatgtaaactatgtaagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
37358873 |
cattatttgcactgtcagttcttggttgccagccattttcataaacaatgtcagagaatgtccacaacaaaacagaaataaaatttaaactatgtaagct |
37358774 |
T |
|
| Q |
201 |
gtattcataagtttaaggtgcagtataagt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37358773 |
gtattcataagtttaaggtgcagtataagt |
37358744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University