View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_232 (Length: 247)
Name: NF1498_high_232
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_232 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 36984920 - 36984709
Alignment:
| Q |
18 |
acatataagatgaatgatgaacaatactgaaccacttattggctccagcttttgtatctatcttcgtttctctttatgaaaatgacaatttttgaggtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36984920 |
acatataagatgaatgatgaacaatattgaaccacttattggctccagcttttgtatctatcttcgtttctctttatgaaaatgacaatttttgaggtta |
36984821 |
T |
|
| Q |
118 |
tttaaaaactcattcaacaaattattaattttaaaactttctaataacgaaagaaagtgacaattccatcttaatgcgctgtcatgggcatggccaccgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36984820 |
tttaaaaactcattcaacaaattattaattttaaaactttctaataacgaaagaaagtgacaattccatcttaatgcgctgtcatgggcatggccaccgt |
36984721 |
T |
|
| Q |
218 |
ccttttacgttc |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36984720 |
ccttttacgttc |
36984709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University