View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_241 (Length: 243)
Name: NF1498_high_241
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_241 |
 | |
|
| [»] scaffold0102 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0102 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 25 - 243
Target Start/End: Complemental strand, 24385 - 24167
Alignment:
| Q |
25 |
cttcccttattggataaactctgcaaaaaattatttcaatttcgaacttagattgttttcgatcatttccaatggtgaggtcttaatcatttaagttggt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
24385 |
cttcccttattggataaactctgcaaaaaattatttcaatttcgtacttagattgtattcgaccattttcaatggtgaggtcttaatcattcaagctggt |
24286 |
T |
|
| Q |
125 |
gcctgataggtatctttattgagaannnnnnnaaggatcttataagacctagggcttcacttaagtatctcattattaagtggaccccacactacttttc |
224 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
24285 |
gcctgataggtatctttattgagaatttttttagggatcttataagacctagggcttcacttaagtatctcattattaagttgaccccacaatacttttc |
24186 |
T |
|
| Q |
225 |
attaaattaaggggaatta |
243 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
24185 |
attaaattaaggagaatta |
24167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 4747234 - 4747186
Alignment:
| Q |
183 |
acttaagtatctcattattaagtggaccccacactacttttcattaaat |
231 |
Q |
| |
|
||||||| |||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
4747234 |
acttaagcatctcattcttaagtggaccccgtaatacttttcattaaat |
4747186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 230
Target Start/End: Original strand, 42400937 - 42401005
Alignment:
| Q |
162 |
tcttataagacctagggcttcacttaagtatctcattattaagtggaccccacactacttttcattaaa |
230 |
Q |
| |
|
|||| ||||||| |||| ||||||||| || ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
42400937 |
tcttctaagacccagggtctcacttaagacccttattcttaagtggaccccacactactttttattaaa |
42401005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University