View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_244 (Length: 241)
Name: NF1498_high_244
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_244 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 15149284 - 15149077
Alignment:
| Q |
1 |
aatgaagccagcttatagatcaat--tcatttgaaaaaatgggctaaagataagtattgtacaatgtgaatttcatgttttttctcgttaataaaattct |
98 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15149284 |
aatgaagccagcttatagatcgatattcatttgaaaaaatgggctaaagataagtattgtacaatgtgaatttcatgttttttctcgttaataaaattct |
15149185 |
T |
|
| Q |
99 |
tagttgtaataaatgtgattttctttttctggttttcatcacatgctggatttgctagatgcaaacgattcccagaattaattacttttttaggatatag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15149184 |
tagttgtaataaatgtgattttctttttctggttttcatcacatgctggatttgctagatgcaaacgattaccagaattaattacttttttaggatatag |
15149085 |
T |
|
| Q |
199 |
ttcttatc |
206 |
Q |
| |
|
|||||||| |
|
|
| T |
15149084 |
ttcttatc |
15149077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University