View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_263 (Length: 233)
Name: NF1498_high_263
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_263 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 46521263 - 46521467
Alignment:
| Q |
19 |
gtataggtatataattgaagcaatacccttgtaccttaatttgtttcaccaaatccacataataagaaaacaaatacttgggttgcattaagtcaattcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46521263 |
gtataggtatataattgaagcaatacccttgtaccttaatttgtttcaccaaatccacataataagaaaacaaatacttgggttgcattaagtcaattcc |
46521362 |
T |
|
| Q |
119 |
tttcagc----ttggtttatagagttcagagttatagagcatatataggttcataaagactaaagagtgagttaaaagaaatattttattttatgtgaga |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46521363 |
tttcagcttggttggtttatagagttcagagttatagagcatatataggttcataaagactaaagagtgagttaaaagaaatattttattttatgtgaga |
46521462 |
T |
|
| Q |
215 |
attat |
219 |
Q |
| |
|
||||| |
|
|
| T |
46521463 |
attat |
46521467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University