View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_264 (Length: 233)
Name: NF1498_high_264
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_264 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 41546453 - 41546653
Alignment:
| Q |
12 |
taagtctaagactagaccttactttgtttttcgcgacattcttaacatgactagacctgattttggcgttcttgtcatccttaacatgactagacctgac |
111 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||||||| |||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
41546453 |
taagtctatcactagacctgactttggttttcgcgacatccttaacatgactagacctgactttggctttcttgacatccttaacatgactagacctgac |
41546552 |
T |
|
| Q |
112 |
tttagctttcttgacatccttaacatgtaatgattttgacttccttttatttccctgtaaaatacataacttacacaatcagttacttgcaacaattcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41546553 |
tttagctttcttgacatccttaacatgtaatgattttgacttccttttatttccctgtaaaatacataacttacacaatcagttacttgcaacaattcac |
41546652 |
T |
|
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
41546653 |
t |
41546653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University